New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	Exported	= 299745	99 (1.610)	8 (0.150) +CGCTA	3/88	NT	10.6%	coding (641/1782 nt)	mdlB	fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
	?	Exported	= 1746081	52 (0.850)					coding (500/1335 nt)	srmB	ATP‑dependent RNA helicase

AATCATCAATGGCAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/299731‑299745 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AAGCCCATATCCAGCATACGGTCTGCTTCGT  <  Exported/1746081‑1746051                |||||                                cATCATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGTCGGC       >  1:5502308/2‑46  ATCATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGTCGGCCTCat  <  1:3035133/50‑3  ATCATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGT           <  1:1296963/41‑1  ATCATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGT           <  1:1430596/41‑1   TCATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGT           <  1:4334062/40‑1   TCATCAATGGCATCGCTAAATCCCATATCCAGCATGCGG            <  1:2077166/39‑1    CATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGTCGGC       >  1:604080/1‑43    CATCAATGGCATCGCTAAATCCCATATCCAGCATGCGGTCGGC       >  1:953336/1‑43                |||||                                AATCATCAATGGCAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/299731‑299745 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AAGCCCATATCCAGCATACGGTCTGCTTCGT  <  Exported/1746081‑1746051

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.