New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	Exported	1710515 =	48 (0.780)	6 (0.110) +GGGTAT	3/86	NT	10.7%	coding (533/1512 nt)	yphE	fused predicted sugar transporter subunits and ATP‑binding components of ABC superfamily
	?	Exported	= 2983235	66 (1.080)					coding (250/1425 nt)	creC	sensory histidine kinase in two‑component regulatory system with CreB or PhoB, regulator of the CreBC regulon
Rejected: Coverage evenness skew score above cutoff.

GTCATTCTTGATGAACCTACCAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/1710537‑1710515 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CGATATTGGCGCGA  <  Exported/2983235‑2983222                        ||||||               cTCATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  <  1:5204709/42‑1  TCATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  <  1:3854347/42‑1    ATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  >  1:3535657/1‑40    ATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  >  1:3793357/1‑40    ATTCTTGATGAACCCA‑CAGGGGTATCGATATTGGCGCGA  >  1:4994910/1‑39        TTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  >  1:4053519/1‑36                        ||||||               GTCATTCTTGATGAACCTACCAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/1710537‑1710515 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CGATATTGGCGCGA  <  Exported/2983235‑2983222

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.